Review



neuronal specific mecp2 promoter  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 94
      Buy from Supplier

    Structured Review

    Addgene inc neuronal specific mecp2 promoter
    Neuronal Specific Mecp2 Promoter, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 20 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mecp2+promoter/MECP2+(Plasmid+%23155723)/pmc10014281__mmc2-194-11-26
    Average 94 stars, based on 20 article reviews
    neuronal specific mecp2 promoter - by Bioz Stars, 2026-10
    94/100 stars

    Images

    Related Articles

    Plasmid Preparation:

    Article Title: Acoustically Targeted Noninvasive Gene Therapy in Large Brain Regions
    Article Snippet: .. The plasmid PX551 (Addgene #60957) was used for the SpCas9, expressed under the Mecp2 promoter. .. To construct the sgRNA plasmid, PX552 (Addgene #60958) was digested with SapI (New England Biolabs, Ipswich, MA) and inserted with a 20-nucleotide spacer sequence (5’-aagtaaaacctctacaaatg-3’), which targets the stop cassette upstream of the tdTomato gene in Ai9 mice.

    Article Title: Delta glutamate receptor conductance drives excitation of mouse dorsal raphe neurons
    Article Snippet: A portion of the finished PCR reac- tion was treated with Bgl I restriction enzyme (New England Biolabs) for 60 min and processed on an AATI fragment analyzer. .. The AAV vector plasmid encoding SpCas9 (Swiech et al., 2015) (pX551) expressed from the Mecp2 promoter was a gift from Feng Zhang (Addgene plasmid # 60957, AAV-Cas9). .. The AAV packaging plasmid encoding a nuclear envelope-embedded eGFP reporter (Addgene 131682) was constructed by amplifying the KASH domain from (Addgene 60231, a gift of Feng Zhang) and fusing it (in-frame) to the end of coding region for eGFP in (Addgene 60058, pOTTC407) using ligation-independent cloning (AAV-empty, Figure 5—figure supplement 1A). gRNA was cloned into a mU6 expression cassette and then moved into an AAV backbone expressing a nuclear envelope-embedded (KASH- tagged) eGFP reporter (Addgene 131683) by PCR amplification and ligation-independent cloning (AAV-Grid1).

    Article Title: Delta glutamate receptor conductance drives excitation of mouse dorsal raphe neurons
    Article Snippet: A portion of the finished PCR reaction was treated with Bgl I restriction enzyme (New England Biolabs) for 60 min and processed on an AATI fragment analyzer. .. The AAV vector plasmid encoding SpCas9 ( ) (pX551) expressed from the Mecp2 promoter was a gift from Feng Zhang (Addgene plasmid # 60957, AAV-Cas9). .. The AAV packaging plasmid encoding a nuclear envelope-embedded eGFP reporter (Addgene 131682) was constructed by amplifying the KASH domain from (Addgene 60231, a gift of Feng Zhang) and fusing it (in-frame) to the end of coding region for eGFP in (Addgene 60058, pOTTC407) using ligation-independent cloning (AAV-empty, ). gRNA was cloned into a mU6 expression cassette and then moved into an AAV backbone expressing a nuclear envelope-embedded (KASH-tagged) eGFP reporter (Addgene 131683) by PCR amplification and ligation-independent cloning (AAV- Grid1 ).

    Article Title: Delta glutamate receptor conductance drives excitation of dorsal raphe neurons
    Article Snippet: A portion of the finished PCR reaction was treated with Bgl I restriction enzyme (New England Biolabs) for 60 minutes and processed on an AATI fragment analyzer. .. The AAV vector plasmid encoding SpCas9 (pX551) expressed from the MeCP2 promoter was a gift from Feng Zhang (Addgene plasmid # 60957, AAV-Cas9). .. The AAV packaging plasmid encoding a nuclear envelope-embedded eGFP reporter (Addgene 131682) was constructed by amplifying the KASH domain from (Addgene 60231, a gift of Feng Zhang) and fusing it (in-frame) to the end of coding region for eGFP in (Addgene 60058, pOTTC407) using ligation-independent cloning (AAV-empty, ). gRNA was cloned into a mU6 expression cassette and then moved into an AAV backbone expressing a nuclear envelope-embedded (KASH-tagged) eGFP reporter (Addgene 131683) by PCR amplification and ligation-independent cloning (AAV-GRID1).

    Virus:

    Article Title: In vivo CRISPRa decreases seizures and rescues cognitive deficits in a rodent model of epilepsy
    Article Snippet: .. To generate an adeno-associated virus (AAV) with activating dCas9 (dCas9-VP64) under a doxycycline-inducible promoter, and tetracycline transactivator responsive element (TRE), we used AAV-SpCas9 (a gift from F. Zhang, Addgene #PX551) as the starting material: the Mecp2 promoter was removed by XbaI/AgeI digestion and the TRE promoter was amplified using the primers: FWXbaI: 5′-GCTCTAGACCAGTTTGGTTAGATCTC-3′; and RV AgeI: 5′-GCACCGGTGCGATCTGACGGTTCACT-3′. .. SpCas9 was removed using AgeI/EcoRI and Cas9m4-VP64 (a gift from G. Church, Addgene #47319) was digested with AgeI/EcoRI.

    Bioprocessing:

    Article Title: In vivo CRISPRa decreases seizures and rescues cognitive deficits in a rodent model of epilepsy
    Article Snippet: .. To generate an adeno-associated virus (AAV) with activating dCas9 (dCas9-VP64) under a doxycycline-inducible promoter, and tetracycline transactivator responsive element (TRE), we used AAV-SpCas9 (a gift from F. Zhang, Addgene #PX551) as the starting material: the Mecp2 promoter was removed by XbaI/AgeI digestion and the TRE promoter was amplified using the primers: FWXbaI: 5′-GCTCTAGACCAGTTTGGTTAGATCTC-3′; and RV AgeI: 5′-GCACCGGTGCGATCTGACGGTTCACT-3′. .. SpCas9 was removed using AgeI/EcoRI and Cas9m4-VP64 (a gift from G. Church, Addgene #47319) was digested with AgeI/EcoRI.

    Article Title: Delta glutamate receptor conductance drives excitation of mouse dorsal raphe neurons
    Article Snippet: A portion of the finished PCR reac- tion was treated with Bgl I restriction enzyme (New England Biolabs) for 60 min and processed on an AATI fragment analyzer. .. The AAV vector plasmid encoding SpCas9 (Swiech et al., 2015) (pX551) expressed from the Mecp2 promoter was a gift from Feng Zhang (Addgene plasmid # 60957, AAV-Cas9). .. The AAV packaging plasmid encoding a nuclear envelope-embedded eGFP reporter (Addgene 131682) was constructed by amplifying the KASH domain from (Addgene 60231, a gift of Feng Zhang) and fusing it (in-frame) to the end of coding region for eGFP in (Addgene 60058, pOTTC407) using ligation-independent cloning (AAV-empty, Figure 5—figure supplement 1A). gRNA was cloned into a mU6 expression cassette and then moved into an AAV backbone expressing a nuclear envelope-embedded (KASH- tagged) eGFP reporter (Addgene 131683) by PCR amplification and ligation-independent cloning (AAV-Grid1).

    Article Title: In vivo CRISPRa decreases seizures and rescues cognitive deficits in a rodent model of epilepsy
    Article Snippet: .. AAV-TRE-dCas9-VP64 was obtained by restriction digestion of AAV-SpCas9 (gift of F. Zhang, Addgene # PX551) where the Mecp2 promoter was removed by XbaI/AgeI digestion and TRE promoter was amplified with the following primers: FWXbaI: GCTCTAGACCAGTTTGGTTAGATCTC and RV AgeI GCACCGGTGCGATCTGACGGTTCACT. .. SpCas9 was removed with AgeI/EcoRI and Cas9m4-VP64 (gift of G. Church, addgene # 47319) was digested with AgeI/EcoRI.

    Article Title: Delta glutamate receptor conductance drives excitation of mouse dorsal raphe neurons
    Article Snippet: A portion of the finished PCR reaction was treated with Bgl I restriction enzyme (New England Biolabs) for 60 min and processed on an AATI fragment analyzer. .. The AAV vector plasmid encoding SpCas9 ( ) (pX551) expressed from the Mecp2 promoter was a gift from Feng Zhang (Addgene plasmid # 60957, AAV-Cas9). .. The AAV packaging plasmid encoding a nuclear envelope-embedded eGFP reporter (Addgene 131682) was constructed by amplifying the KASH domain from (Addgene 60231, a gift of Feng Zhang) and fusing it (in-frame) to the end of coding region for eGFP in (Addgene 60058, pOTTC407) using ligation-independent cloning (AAV-empty, ). gRNA was cloned into a mU6 expression cassette and then moved into an AAV backbone expressing a nuclear envelope-embedded (KASH-tagged) eGFP reporter (Addgene 131683) by PCR amplification and ligation-independent cloning (AAV- Grid1 ).

    Article Title: Delta glutamate receptor conductance drives excitation of dorsal raphe neurons
    Article Snippet: A portion of the finished PCR reaction was treated with Bgl I restriction enzyme (New England Biolabs) for 60 minutes and processed on an AATI fragment analyzer. .. The AAV vector plasmid encoding SpCas9 (pX551) expressed from the MeCP2 promoter was a gift from Feng Zhang (Addgene plasmid # 60957, AAV-Cas9). .. The AAV packaging plasmid encoding a nuclear envelope-embedded eGFP reporter (Addgene 131682) was constructed by amplifying the KASH domain from (Addgene 60231, a gift of Feng Zhang) and fusing it (in-frame) to the end of coding region for eGFP in (Addgene 60058, pOTTC407) using ligation-independent cloning (AAV-empty, ). gRNA was cloned into a mU6 expression cassette and then moved into an AAV backbone expressing a nuclear envelope-embedded (KASH-tagged) eGFP reporter (Addgene 131683) by PCR amplification and ligation-independent cloning (AAV-GRID1).

    Amplification:

    Article Title: In vivo CRISPRa decreases seizures and rescues cognitive deficits in a rodent model of epilepsy
    Article Snippet: .. To generate an adeno-associated virus (AAV) with activating dCas9 (dCas9-VP64) under a doxycycline-inducible promoter, and tetracycline transactivator responsive element (TRE), we used AAV-SpCas9 (a gift from F. Zhang, Addgene #PX551) as the starting material: the Mecp2 promoter was removed by XbaI/AgeI digestion and the TRE promoter was amplified using the primers: FWXbaI: 5′-GCTCTAGACCAGTTTGGTTAGATCTC-3′; and RV AgeI: 5′-GCACCGGTGCGATCTGACGGTTCACT-3′. .. SpCas9 was removed using AgeI/EcoRI and Cas9m4-VP64 (a gift from G. Church, Addgene #47319) was digested with AgeI/EcoRI.

    Article Title: In vivo CRISPRa decreases seizures and rescues cognitive deficits in a rodent model of epilepsy
    Article Snippet: .. AAV-TRE-dCas9-VP64 was obtained by restriction digestion of AAV-SpCas9 (gift of F. Zhang, Addgene # PX551) where the Mecp2 promoter was removed by XbaI/AgeI digestion and TRE promoter was amplified with the following primers: FWXbaI: GCTCTAGACCAGTTTGGTTAGATCTC and RV AgeI GCACCGGTGCGATCTGACGGTTCACT. .. SpCas9 was removed with AgeI/EcoRI and Cas9m4-VP64 (gift of G. Church, addgene # 47319) was digested with AgeI/EcoRI.

    other:

    Article Title: dCas9-Based Scn1a Gene Activation Restores Inhibitory Interneuron Excitability and Attenuates Seizures in Dravet Syndrome Mice
    Article Snippet: For video EEG recording, the implanted electrodes were connected via flexible cables to an amplifier, and the EEG signal was sampled at 256 Hz, coded with 16 bits, and digitally saved using a System Plus device (Micromed, Mogliano Veneto, Italy).



    Similar Products

    neuronal specific mecp2 promoter  (Addgene inc)
    94
    Addgene inc neuronal specific mecp2 promoter
    Neuronal Specific Mecp2 Promoter, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mecp2+promoter/MECP2+(Plasmid+%23155723)/pmc10014281__mmc2-194-11-26
    Average 94 stars, based on 1 article reviews
    neuronal specific mecp2 promoter - by Bioz Stars, 2026-10
    94/100 stars
    		  Buy from Supplier
    mecp2 promoter  (Addgene inc)
    94
    Addgene inc mecp2 promoter
    a) We delivered AAV9 carrying a guide RNA and GFP under neuronal promoter, and another AAV9 carrying spCas9 under <t>MECP2</t> promoter into 22 sites in the mouse brain. b) We observed GFP and tdTomato expression in the targeted sites, but not in the contralateral controls. c) Transduction efficiency of gRNA and GFP reached 24.1±2.1% and was significantly higher than in untargeted sites (p<0.0001, two-tailed paired t-test, n=110 sites in 5 mice). d) The gene editing efficiency was lower at 7.3±1.4%, but also significantly higher than the untargeted brain regions (p<0.0001, two-tailed paired t-test, n=110 sites in 5 mice). e) We counted neurons at the targeted sites and contralateral controls, and found lower numbers of neurons in the former, indicating a possible neuronal loss. Scale bars represent 1000 microns for a), b).*, p<0.05, **, p<0.01, ***, p<0.001, ****, p<0.0001. (green fluorescent protein, GFP).(Image created with biorender.com )
    Mecp2 Promoter, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mecp2+promoter/MECP2+(Plasmid+%23155723)/bio_rxiv__2023__01__19__524626-158-13-3
    Average 94 stars, based on 1 article reviews
    mecp2 promoter - by Bioz Stars, 2026-10
    94/100 stars
    		  Buy from Supplier
    mouse mecp2 promoter sequence  (Danaher Inc)
    86
    Danaher Inc mouse mecp2 promoter sequence
    a) We delivered AAV9 carrying a guide RNA and GFP under neuronal promoter, and another AAV9 carrying spCas9 under <t>MECP2</t> promoter into 22 sites in the mouse brain. b) We observed GFP and tdTomato expression in the targeted sites, but not in the contralateral controls. c) Transduction efficiency of gRNA and GFP reached 24.1±2.1% and was significantly higher than in untargeted sites (p<0.0001, two-tailed paired t-test, n=110 sites in 5 mice). d) The gene editing efficiency was lower at 7.3±1.4%, but also significantly higher than the untargeted brain regions (p<0.0001, two-tailed paired t-test, n=110 sites in 5 mice). e) We counted neurons at the targeted sites and contralateral controls, and found lower numbers of neurons in the former, indicating a possible neuronal loss. Scale bars represent 1000 microns for a), b).*, p<0.05, **, p<0.01, ***, p<0.001, ****, p<0.0001. (green fluorescent protein, GFP).(Image created with biorender.com )
    Mouse Mecp2 Promoter Sequence, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mecp2+promoter/us11352647-7201-26-30
    Average 86 stars, based on 1 article reviews
    mouse mecp2 promoter sequence - by Bioz Stars, 2026-10
    86/100 stars
    		  Buy from Supplier
    mecp2 promoter-driven luciferase reporter plasmid  (SwitchGear Genomics)
    90
    SwitchGear Genomics mecp2 promoter-driven luciferase reporter plasmid
    a) We delivered AAV9 carrying a guide RNA and GFP under neuronal promoter, and another AAV9 carrying spCas9 under <t>MECP2</t> promoter into 22 sites in the mouse brain. b) We observed GFP and tdTomato expression in the targeted sites, but not in the contralateral controls. c) Transduction efficiency of gRNA and GFP reached 24.1±2.1% and was significantly higher than in untargeted sites (p<0.0001, two-tailed paired t-test, n=110 sites in 5 mice). d) The gene editing efficiency was lower at 7.3±1.4%, but also significantly higher than the untargeted brain regions (p<0.0001, two-tailed paired t-test, n=110 sites in 5 mice). e) We counted neurons at the targeted sites and contralateral controls, and found lower numbers of neurons in the former, indicating a possible neuronal loss. Scale bars represent 1000 microns for a), b).*, p<0.05, **, p<0.01, ***, p<0.001, ****, p<0.0001. (green fluorescent protein, GFP).(Image created with biorender.com )
    Mecp2 Promoter Driven Luciferase Reporter Plasmid, supplied by SwitchGear Genomics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mecp2+promoter/mecp2+promoter+driven+luciferase+reporter+plasmid/pmc06750972-94-1-9
    Average 90 stars, based on 1 article reviews
    mecp2 promoter-driven luciferase reporter plasmid - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier

    Image Search Results


    a) We delivered AAV9 carrying a guide RNA and GFP under neuronal promoter, and another AAV9 carrying spCas9 under MECP2 promoter into 22 sites in the mouse brain. b) We observed GFP and tdTomato expression in the targeted sites, but not in the contralateral controls. c) Transduction efficiency of gRNA and GFP reached 24.1±2.1% and was significantly higher than in untargeted sites (p<0.0001, two-tailed paired t-test, n=110 sites in 5 mice). d) The gene editing efficiency was lower at 7.3±1.4%, but also significantly higher than the untargeted brain regions (p<0.0001, two-tailed paired t-test, n=110 sites in 5 mice). e) We counted neurons at the targeted sites and contralateral controls, and found lower numbers of neurons in the former, indicating a possible neuronal loss. Scale bars represent 1000 microns for a), b).*, p<0.05, **, p<0.01, ***, p<0.001, ****, p<0.0001. (green fluorescent protein, GFP).(Image created with biorender.com )

    Journal: bioRxiv

    Article Title: Acoustically Targeted Noninvasive Gene Therapy in Large Brain Regions

    doi: 10.1101/2023.01.19.524626

    Figure Lengend Snippet: a) We delivered AAV9 carrying a guide RNA and GFP under neuronal promoter, and another AAV9 carrying spCas9 under MECP2 promoter into 22 sites in the mouse brain. b) We observed GFP and tdTomato expression in the targeted sites, but not in the contralateral controls. c) Transduction efficiency of gRNA and GFP reached 24.1±2.1% and was significantly higher than in untargeted sites (p<0.0001, two-tailed paired t-test, n=110 sites in 5 mice). d) The gene editing efficiency was lower at 7.3±1.4%, but also significantly higher than the untargeted brain regions (p<0.0001, two-tailed paired t-test, n=110 sites in 5 mice). e) We counted neurons at the targeted sites and contralateral controls, and found lower numbers of neurons in the former, indicating a possible neuronal loss. Scale bars represent 1000 microns for a), b).*, p<0.05, **, p<0.01, ***, p<0.001, ****, p<0.0001. (green fluorescent protein, GFP).(Image created with biorender.com )

    Article Snippet: The plasmid PX551 (Addgene #60957) was used for the SpCas9, expressed under the Mecp2 promoter.

    Techniques: Expressing, Transduction, Two Tailed Test